“God said: Your life is contained within your DNA. Your life may have been mapped out, but it is not set. There is no stalemate. There is room for growth. What you are is inviolable, but your DNA is malleable. Authored by thought, it is affected by your thoughts. As your vision broadens, your code is smoothed out, perhaps altered. Your self-realization is found within your DNA.

A guarantee comes encoded within your DNA. The guarantee is that your code is not fixed. The guarantee is that you will blossom forth and be what you design to be. Your designation may vary. What does not vary is the guarantee, signed in My Name, that says you will become Self-realized.

Sure, your DNA may be a map, and it has wavy lines and tiny print in it, but it is also a map of something. It is a map of Divinity enclosed in a Human body. By your intent, you foster the unveiling of your divinity. You free it. All the means for this are reflected in every cell of the physical body. But the release of your divinity comes through your heart, your heart, your beautiful beating heart.

Within your heart lies the release button. Within your cellular structure lies the code.

Consider the code an echo. The echo is heard clearly in one place and more muffled in another. Clear the path for your DNA.

Your DNA is definitely subject to change. It would be more accurate to say a clearing. This would be like a clearing or rebuilding or reinforcing. Letting go of the past complexion of your thinking is letting go of the sludge of your past DNA, from all the pasts. When you let go of the past, your DNA automatically surges forward. Your DNA follows the paths you make in your mind. There is a mutual exchange here. Your DNA affects you, and you affect it.

Within your cells is what would be called an empty space. But it is not empty but full. It is full of all your possibilities, and it is full of Me.

It is a battery charged. Fully charged. A battery provides energy, according to the use it is put to. The energy that I gave you is cyclotronic. To what use do you put it?

Your thoughts activate your heart. Your heart sends your messages inward and outward in one surge.

Draw to your heart the thoughts you want. Do not proclaim to be innocent of the nature of your thoughts. They are your thoughts. They follow your will. You are the initiator of your thoughts. No matter how it seems to you, you are the founder of your thoughts. Certainly, you are the one who keeps them or lets them go.

Let go of the shades of past thought, and your DNA will leap into a new configuration joyously.” http://www.heavenletters.org/your-dna.html

_________________________________________

God’s DNA fills our cells

“God said: Your heart is My heart. My heart is enclosed in yours, and yours is enclosed in Mine. By the same token, My DNA fills your cells. My DNA is love. Let My love fill your cells. Feel My love entering every cell of your body. Let there be an onslaught of My love filling your cells. Let My love flood your cells.” http://www.heavenletters.org/gods-dna-fills-your-cells.html

In these opening long quotes from the Heavenletter “Your DNA” published in 2003, we might wonder if God is speaking about DNA only in metaphorical terms or if there is a de facto connection between our Creator and the DNA that fills our cells.

Some of God’s statements are also mind puzzling: (1) Our life is contained within our DNA. (2) Our life might be mapped out but it is not set. What we are is unchangeable but our DNA is malleable. Even if DNA has been mapped out like our life, it is not set. (3) And most of all, our DNA is affected by our thoughts. God says that His DNA is love. So is there also a written genetic code for love?

How can we situate our current knowledge of the human genetic code in regard to God’s exposé on our DNA? When God speaks of a malleable DNA, of a room for growth on it, does He have the same idea in mind as geneticists have concerning cloning, genetic engineering, or genetic improvement of the human species?

I think that if there is a connection between our nature of light beings and our DNA, we don’t have to wait for science to make an idea of our own on the subject. Yet, we don’t pretend to totally encompass such a complex and controversial subject in the few forthcoming blogs on God’s DNA but if God Himself is talking about our DNA, then it is legitimate to try to understand what He wants to tell us in those seemingly enigmatic statements.

The Scrabble of letters and numbers

When we talk about genetic code in particular or code in a broader sense, we are generally referring to a system of symbols and rules (grammar) used to represent instructions to a computer (a biological analogical computer like the brain or a digital man-made computer). We are now used to call the code a “program” like a computer program. Code can also be defined as a system of electric signals (binary 1 and 0, switch on/off position written in machine language) or bioelectric signals in neuronal networks used to represent letters or numbers in transmitting messages.

At the same time, it is more and more acknowledged that frontier science and especially noetic science has reached a point of convergence with ancient knowledge and wisdom systems. Yet this convergence is not always smooth because of the seemingly radically opposite approach or methodology to knowledge used by modern science and traditional systems. This is particularly evident in the contrast between the use of numbers and letters by traditional knowledge and by contemporary science.

In contemporary societies, there is a clear distinction between the use of language for general communication purposes and the use of the mathematical language for scientific purposes. It is like if a separation has been made between the letters used for discursive language and the numbers used to express the “reality” of the physical world. Modern science uses complex mathematical equations where letters are not assembled to form meaningful words but as “variables” that are to be processed by complex mathematical formulas (calculus for example). We have seen this particular use of letters in the celebrated formula E=mc2 where letters are placeholders to receive mathematical values. In fact, most of the work a computer processor does is to calculate those letters as value placeholders (variables) to generate a “graphic” letter, a figure, or anything that is displayed on a monitor.

Certain ancient knowledge and wisdom systems also used letters and numbers to express reality, but not only the physical reality (like the mathematics of physics) but the whole realm of reality, from the physical level to the spiritual level. Letters and numbers where not only placeholders for something else, they were the building blocks of reality and they were reproducing by complementarity, that is the number was reproducing itself through the letter it corresponds to and the letter was reproducing itself through the number it corresponds to (like in genetic, a nucleotide is reproduced by its complementary base and not by duplication of itself).

Letters of fire

In the Sepher Yetzirah or “The scroll of formation”, a treatise of Kabbala (esoteric interpretation of the Thorah), it is written that Yahweh (יהוה) created His universe (by writing with letters of fire and calculating) with or by 3 Sepharim: Sepher (the scroll on which it is written), Sephar (what is counted: numbers), and Sippur (what is narrated or communicated: the script or the story itself). It is fascinating that calculations (essentially additions) can be performed on what is written (text) with letters of an aleph-beth (alphabet in Hebrew) and that the medium on which the writing and calculations are done at the same time is a scroll that wraps and unwraps itself like a helicoid (helix) in the shape of a cylinder that becomes a flat sheet, like a piano score.

In fact, the image that comes to mind in the trio of scroll-number-text is the musical staff.  The notes have a name, they have a number (a frequency) and they are held by the staff, the spinal cord, the scroll that establishes the relation between the letters and their vibrational frequencies, and unfolds the vibrations into a narrative sequence in time and space. This constitutes a real tri-unity where each element is defined by the two others. It intrinsically contains its own grammatical rules. “In the beginning was the Verb”. The Verb is a creative frequency and it is a grammatical function. Numbers and letters are one, like architecture and music.

In our modern languages, there are no deep connections between the letters of the alphabet and their respective frequencies as if the frequency was no longer conveying any meaning to the letter.

That is probably why biblical Hebrew has been viewed as the only living language that has kept intact the written form of its original text. We know that Hebrew is not the oldest language, that it comes from Egyptian, Chaldean, and Syriac but it is the only one that has kept integrally its total link between the letters and the numbers. Modifying the letters would mean modifying the value of the words.

Numbers that create a story written in words

It is now accepted that the physical universe is defined by numbers. We saw in previous blogs that all our experiences can be mathematically described by waveforms with complex numbers. These complex numbers are expressed through fractal attractor models. These information processes which ensure the order or coherence of the universe are very different from the binary processing of information through computers. They are analogous.

Mathematical equations (Jean Fourier) show how information manifests the outside phenomena that we call reality. All schemes and phenomena are translated in a mathematical language expressing waves. These waves can generate the “realities” of phenomena (holograms).

Interestingly, yet with a much simpler mathematical approach, kabbala deals only with whole numbers and the only mathematical operation used (which is more simply arithmetical) is the addition plus the reduction of any number equal or greater than 10 to a whole value between 1 and 9. The whole arithmetical process is called gematria. (There are other types of operations on letters and numbers in the kabbala, but we will keep things as simple as possible here).  Kabbalists use the letters of the Hebrew Aleph-Beith to express the electromagnetic waves that are in perpetual movement (back and forth in symmetrical time?) across different states of the living energy. That is why numbers are tied to letters. Numbers are the vibrational frequencies of the letters. Letters are the manifested expressions of the numbers they represent.

Before entering into the core of our topic, we have to mention that the convergence of Kabbala and contemporary physics is creating and will create frictions, reactions oscillating between the feelings of bliss and sham. Perhaps an open mind attitude is preferable for the moment…

Ancient and contemporary studies of the Kabbala are numerous. Some of them are of very high quality. But they are complex and very esoteric. Let us see if we can extract accessible messages that can throw light on the divine source of our DNA.

A first convergence of genetics and Kabbala

After many years of compilation, we now possess the map of the complete human genome with its alignment on a helicoid of the sequences of nucleotides that define the genes on each of the 23 chromosomes of the human species.

The map of the human gene sequences is written as a long and continuous chain of bases (A for adenine-T for thymine-G for guanine –C for cytosine) of the type:

—> GATCAATGAGGTGGACACCAGAGGCGGGACT…—>

for each of the 23 human chromosomes.

The original scroll of the Thora is also written as a long uninterrupted chain of letters (reading from left to right):

<—…בראשיתבראאלהיםאתהשמיםואתהארץ<—        

Like in the sequence of nucleotides, where the geneticist knows where a word (gene) starts and finish in this sequence of ATGC (there is also punctuation signs that separate the genes along this continuous strip of letters), the Kabbalist knows where the words start and end in this continuous sequence of letters:

<—…בראשית  ברא  אלהים  את-השמים ואת–הארץ <—

But where is the connection between the double helix of the DNA molecule and the Hebrew Aleph-Beith?

The kabbalistic Hebrew alphabet is an alphabet based on oneness. The numeric system is based on the number 9 rather than the number 10 of our base-10 system. The first letter of the alphabet is Aleph and its value is 1. Numbers exist only in letter-written form.
Observe the shape of the א which could correspond to the Greek alpha α and our roman a. It is a stylized helicoid. This letter א is composed of 4 letters. It is a composition of Yod י, Waw ו (or Vav), and 2 He ה (one seems upside down). — It is to be noticed that all the Hebrew letters are formed by one basic character which appears in a short version, the Yod י and its elongated version, the Waw/Vav ו —. The letter Aleph seems really dynamic, like if it was rotating in a spiral movement, just like the DNA molecule.

If we were to despiralize this Aleph, it would form the linear sequence (please read from right to left, as it should in Hebrew):

  א ∞  יהוה

 which is the name of God. The aleph is the scroll, the staff holding together the letters of the aleph-beth and their frequencies like the double helix of the DNA molecule.

[To be continued… ]

Written by Normand Bourque on Jun 15, 2013